|
Sangon Biotech
tctagcagagcacggatgtgtttg3 Tctagcagagcacggatgtgtttg3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/10__1016_slash_j__isci__2025__113396-606-34-35?v=Sangon+Biotech Average 86 stars, based on 1 article reviews
tctagcagagcacggatgtgtttg3 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Proteintech
p38 66234 1 ig mouse P38 66234 1 Ig Mouse, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/pmc12512320__13287_2025_4666_MOESM1_ESM-13-135-140?v=Proteintech Average 96 stars, based on 1 article reviews
p38 66234 1 ig mouse - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Boster Bio
p38 mitogen activated protein kinase mapk antibody ![]() P38 Mitogen Activated Protein Kinase Mapk Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/pmc05812251-50-91-110?v=Boster+Bio Average 93 stars, based on 1 article reviews
p38 mitogen activated protein kinase mapk antibody - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Aviva Systems
antiphospho thr ![]() Antiphospho Thr, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/10__1074_slash_jbc__m109__061515-44-8-21?v=Aviva+Systems Average 90 stars, based on 1 article reviews
antiphospho thr - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
PhosphoSolutions
anti p38 pt180 y182 ![]() Anti P38 Pt180 Y182, supplied by PhosphoSolutions, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/pmc05354443-254-127-131?v=PhosphoSolutions Average 96 stars, based on 1 article reviews
anti p38 pt180 y182 - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Elabscience Biotechnology
p38 ![]() P38, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/10__3390_slash_cells15080667-77-28-30?v=Elabscience+Biotechnology Average 96 stars, based on 1 article reviews
p38 - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
Revvity
p p38 mapk thr180 tyr182 kits ![]() P P38 Mapk Thr180 Tyr182 Kits, supplied by Revvity, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/pm32611725-71-18-26?v=Revvity Average 90 stars, based on 1 article reviews
p p38 mapk thr180 tyr182 kits - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
erk1 ![]() Erk1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/pm35754026-93-11-27?v=OriGene Average 90 stars, based on 1 article reviews
erk1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ProSci Incorporated
p38 ![]() P38, supplied by ProSci Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/10__1158_slash_0008___5472__can___08___3797-119-53-73?v=ProSci+Incorporated Average 90 stars, based on 1 article reviews
p38 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
erk2 3 utr ![]() Erk2 3 Utr, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/pmc04253445-161-15-8?v=OriGene Average 90 stars, based on 1 article reviews
erk2 3 utr - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
mapk1 nm 138957 human tagged orf ![]() Mapk1 Nm 138957 Human Tagged Orf, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/pmc11982726-54-1-13?v=OriGene Average 93 stars, based on 1 article reviews
mapk1 nm 138957 human tagged orf - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Bio-Rad
phospho p38 ![]() Phospho P38, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/p38+mapk/tourtellotte_joel__2010__activation_of_the_map_kinase_slt2_by_perturbations_in_the_state_of_the_endoplasmic_reticulum-351-16-31?v=Bio-Rad Average 93 stars, based on 1 article reviews
phospho p38 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research
Article Title: Silencing Ras-Related C3 Botulinum Toxin Substrate 1 Inhibits Growth and Migration of Hypopharyngeal Squamous Cell Carcinoma via the P38 Mitogen-Activated Protein Kinase Signaling Pathway
doi: 10.12659/MSM.907468
Figure Lengend Snippet: Silencing Rac1 inhibits the activation of P38 MAPK signal in vitro . The levels of MKK3 and p-MKK3 ( A, B ) and P38 and p-P38 ( C, D ) were detected by Western blot analysis. GAPDH served as the internal reference. All experiments were repeated 3 times and the results are presented as mean ±SD. *** P<0.001 compared with the negative control group.
Article Snippet: The membranes were blocked with 5% skim milk or 1% bovine serum albumin, and then incubated with Rac1 antibody, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (1: 1000; Proteintech, Wuhan, China), Cyclin D1 antibody (1: 1000; BOSTER, Wuhan, China), Cyclin E antibody, Cyclin B antibody (1: 500; Bioss, Beijing, China), metal matrix proteinase (MMP)-2 antibody, MMP-9 antibody, B cell lymphoma-2 (Bcl-2) antibody, Bcl-2-associated X protein (Bax) antibody, phosphorylated-MAP kinase (p-MKK3) antibody (1: 500; Sangon Biotech, Shanghai, China), caspase-3 antibody, caspase-9 antibody, poly ADP-ribose polymerase (PARP) antibody (1: 1000; Cell Signaling Technology, Beverly, MA, USA),
Techniques: Activation Assay, In Vitro, Western Blot, Negative Control
Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research
Article Title: Silencing Ras-Related C3 Botulinum Toxin Substrate 1 Inhibits Growth and Migration of Hypopharyngeal Squamous Cell Carcinoma via the P38 Mitogen-Activated Protein Kinase Signaling Pathway
doi: 10.12659/MSM.907468
Figure Lengend Snippet: Rac1 silencing inhibits the activation of P38 MAPK signal in vivo . The levels of MKK3 and p-MKK3 ( A, B ) and P38 and p-P38 ( C, D ) in each group were detected by Western blot analysis with GAPDH as the internal reference. All experiments were repeated 3 times. The results are presented as mean ±SD. N=6. *** P<0.001 compared with the negative control group.
Article Snippet: The membranes were blocked with 5% skim milk or 1% bovine serum albumin, and then incubated with Rac1 antibody, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody (1: 1000; Proteintech, Wuhan, China), Cyclin D1 antibody (1: 1000; BOSTER, Wuhan, China), Cyclin E antibody, Cyclin B antibody (1: 500; Bioss, Beijing, China), metal matrix proteinase (MMP)-2 antibody, MMP-9 antibody, B cell lymphoma-2 (Bcl-2) antibody, Bcl-2-associated X protein (Bax) antibody, phosphorylated-MAP kinase (p-MKK3) antibody (1: 500; Sangon Biotech, Shanghai, China), caspase-3 antibody, caspase-9 antibody, poly ADP-ribose polymerase (PARP) antibody (1: 1000; Cell Signaling Technology, Beverly, MA, USA),
Techniques: Activation Assay, In Vivo, Western Blot, Negative Control
Journal: Journal of Biological Chemistry
Article Title: JNK and Ceramide Kinase Govern the Biogenesis of Lipid Droplets through Activation of Group IVA Phospholipase A2
doi: 10.1074/jbc.m109.061515
Figure Lengend Snippet: FIGURE 3. FBS induces the phosphorylation of JNK, p38, and ERK in CHO-K1cells.Serum-starvedCHO-K1cellsweretreatedwith7.5%FBSforthe indicated times. Total and phosphorylated JNK, p38, and ERK were monitored by Western blot.
Article Snippet: Rabbit anti-cPLA2 , anti-phospho-Ser-505-cPLA2 , anti-JNK, anti-phospho-Thr-183/Tyr-185-JNK, anti-p38,
Techniques: Phospho-proteomics, Western Blot
Journal: Journal of experimental & clinical cancer research : CR
Article Title: Inhibition of HSP 90 is associated with potent anti-tumor activity in Papillary Renal Cell Carcinoma.
doi: 10.1186/s13046-022-02416-z
Figure Lengend Snippet: Fig. 3 SNX2112 treatment leads to degradation of HSP90 client proteins in PRCC cells (A) PRCC cell lines (UOK345, UOK337, UOK342, UOK332) were treated with different concentrations of SNX2112 (10 nM, 50 nM and 100 nM) as indicated for 24 h, followed by Western Blot analysis. SNX2112 treatment induced the degradation of client proteins such as MET, AKT and inhibits phosphorylated forms of MET (Y1234/1235), AKT (Ser473) and ERK1/2 (Thr202/Tyr204). Three independent experiments were performed, and a representative blot is shown. B Knockdown of AKT1/2 and ERK1/2 proteins confirmed by western blot. PRCC cells with MET activating mutation (UOK345) or copy number gain of WT MET (UOK342) were transfected with siAKT1/2, siERK1/2 or non-targeting control, lysed and subjected to western blot. The percentage knockdown for AKT1/2 or ERK1/2 levels was calculated for cells treated with targeting siRNA for AKT1/2 or ERK1/2 relative to the cells treated with non-targeting control after being normalized with an internal control (β actin). Data are representative of three independent experiments. Bar graphs represent the mean ± SD, n = 3. *p < 0.05 is considered significant and was calculated by the two tailed Student’s t test. C AKT1/2 and ERK1/2 silencing decreases PRCC cell viability. UOK345 and UOK342 cells were transfected with siAKT1/2, siERK1/2 or non-targeting control and effect on cell viability was assessed at 48 h and 72 h post-transfection by Cell-Titer Glo assay. Data are mean ± SD of three independent experiments. *p < 0.05 is considered significant and was calculated by the two tailed Student’s t test. D AKT1/2 and ERK1/2 knockdown leads to diminished 2D-colony formation. Following transfection (48 h) with siAKT1/2, siERK1/2 and non-targeting control siRNA, UOK345 and UOK342 cells were trypsinized and seeded at very low density (1000–1500 cells/well) in six-well plates. Tumor foci were stained with crystal violet (0.5%) after 10–12 days and imaged with microscopy. *p < 0.05 is considered significant and was calculated by the two tailed Student’s t test or other tests
Article Snippet: For overexpression of AKT1/2 or ERK1/2, GFP-tagged AKT1 (RG220257), AKT2 (RG217733),
Techniques: Western Blot, Knockdown, Mutagenesis, Transfection, Control, Two Tailed Test, Glo Assay, Staining, Microscopy
Journal: Cancer Research
Article Title: Dysfunctional Microvasculature as a Consequence of Shb Gene Inactivation Causes Impaired Tumor Growth
doi: 10.1158/0008-5472.can-08-3797
Figure Lengend Snippet: Figure 5. Cytoskeleton and VEGF-dependent signaling in cultured endothelial cells isolated from Shb knockout or wild-type liver. A, the cytoskeleton of isolated endothelial cells maintained in tissue culture for 5 to 7 d was visualized by staining with rhodamine-phalloidin, showing a less regular shape with numerous extensions in Shb null cells. B, corresponding wild-type control. No clear cytoskeletal difference between wild-type or knockout cells was noted after stimulation with VEGF-A (C, Shb knockout; D, Shb wild type). Addition of VEGF to the control cells (D) produced changes that made the cells resemble the Shb null cells in the absence of VEGF-A. Horizontal scale bar is shown. Equal amounts of protein from the experimental groups (+/, 20 ng/mL VEGF-A for 2 min) were subjected to Western blot analysis for the phosphorylated proteins indicated. Shb blot shows unstimulated cells only. The blots were subjected to densitometric analysis for phosphorylated FAK, total FAK, phosphorylated p38, total p38, pMLC, phosphorylated ERK, and total ERK in three separate experiments. Quantitation of the relative phosphorylation of FAK, MLC, p38, and ERK is also given. Columns, mean; bars, SE. *, P < 0.05; **, P < 0.01 (paired Students’ t test).
Article Snippet: The samples were electrophoresed on SDS-polyacrylamide gels, protein was transferred on to Hybond-P filters (GE Healthcare), and these were then probed for pY-1175 VEGFR-2, total VEGFR-2, pY-397 FAK, total FAK, phosphorylated extracellular signal-regulated kinase (ERK), total ERK, and phosphorylated Akt, total Akt, phosphorylated myosin light chain (pMLC), pY-658 VE-cadherin, phosphorylated p38, and total
Techniques: Cell Culture, Isolation, Knock-Out, Staining, Control, Produced, Western Blot, Quantitation Assay, Phospho-proteomics
Journal: Oncotarget
Article Title: miR-524-5p suppresses the growth of oncogenic BRAF melanoma by targeting BRAF and ERK2
doi:
Figure Lengend Snippet: (A) Schematic diagram of the BRAF reporter construct. BRAF harbors a miR-524-5p binding site within 276-297 nucleotides of the BRAF 3′-UTR. The wild-type BRAF 3′UTR contains a native miR-524-5p binding site; a mutant 3′UTR contains mutations that delete the seed match sequence of miR-524-5p. (B) Transfection of either the wild-type or mutant reporter into HEK293 cells led to the expression of luciferase. The expression level of luciferase was determined by immunoblotting after transfection for 48 hours. The transfection efficiency was normalized to the expression of -galactosidase. (C) Transfection of either 2, 10 or 20 nM mimic miR-524-5p with either the wild-type or mutant pGLO BRAF reporter into HEK293 cells led to the expression of Firefly and Renilla luciferase. The expression level was determined by immunoblotting after transfection for 48 hours. The transfection efficiency was normalized to the expression of Renilla luciferase. The lower panel is the relative qualification value of expression levels of Firefly luciferase versus Renilla luciferase. (D) Schematic diagram of the ERK2 3′-UTR reporter construct. Eight of miR-524-5p binding sites are predicted in the 3′ UTR of the ERK2 mRNA; a mutant 3′UTR of ERK2 reporter contains mutations that delete the 3′end sequence of three potential binding sites of miR-524-5p. (E) HEK293 cells were co-transfected with a luciferase reporter plasmid containing the wild-type ERK2 3′UTR and with miR-524-5p or both miR-524-5p and anti-miR-524-5p. (F) Transfection of either 2, 10 or 20 nM mimic miR-524-5p with either the wild-type or mutant ERK2 reporter into HEK293 cells led to the expression of luciferase. The transfection efficiency was normalized to the expression of β-galactosidase. The lower panel is the relative qualification value of expression levels of luciferase versus β-galactosidase.
Article Snippet: A 580-bp fragment of the BRAF 3′UTR (pMirTarget,
Techniques: Construct, Binding Assay, Mutagenesis, Sequencing, Transfection, Expressing, Luciferase, Western Blot, Plasmid Preparation
Journal: Oncotarget
Article Title: miR-524-5p suppresses the growth of oncogenic BRAF melanoma by targeting BRAF and ERK2
doi:
Figure Lengend Snippet: SK-Mel-19 cells were transfected with 10 nM negative control (NC) or mimic miR-524-5p. After 48 hours, the total cell number was calculated using a hemocytometer (A), and the proliferation activities were detected by the AlamarBlue assay (B). (C) SK-Mel-19 cells were transfected with a miR-524-5p expression plasmid or control vector. The ability to form colonies in soft agar represents the capacity for anchorage-independent growth. After 3 weeks, the number of colonies was calculated (Right panel), and the size of colonies was observed under microscopy (×50 magnification; Left panel). (D) and (E) The proliferation activities in SK-Mel-19 or A375, following transfection of cells with miR-524-5p or/with BRAF (D) or ERK2 (E) were measured. (A-E) All of the quantification data are reported as the mean ± SD of three independent experiments. (Student's t - test: *** p < 0.001).
Article Snippet: A 580-bp fragment of the BRAF 3′UTR (pMirTarget,
Techniques: Transfection, Negative Control, Alamar Blue Assay, Expressing, Plasmid Preparation, Microscopy
Journal: Oncotarget
Article Title: miR-524-5p suppresses the growth of oncogenic BRAF melanoma by targeting BRAF and ERK2
doi:
Figure Lengend Snippet: (A) SK-Mel-19 cells harboring either the pre-mir-524-5p expression plasmid or control vector (Ctrl) were implanted in each thigh of a nude mouse. After 3 weeks, the tumor weight was measured. (Student's t - test: ** p < 0.01). (B) Total RNA was extracted from each tumor, and the expression levels of miR-524-5p were detected by qRT-PCR analysis. (C) and (D) The relative quantification results of protein levels of BRAF or ERK2 in each mouse tumor. The level of BRAF or ERK2 was normalized to GAPDH by ImageJ software analysis (Student's t - test: * p < 0.05). Western blotting was used to monitor the protein expression levels of BRAF, ERK1/2 and GAPDH in each tumor .
Article Snippet: A 580-bp fragment of the BRAF 3′UTR (pMirTarget,
Techniques: Expressing, Plasmid Preparation, Quantitative RT-PCR, Software, Western Blot